Sequence ID | >WENV170013000 |
Genome ID | ASRQ01003793 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 312 |
End posion on genome | 241 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tagataatag |
tRNA gene sequence |
TCCTCAATAGCTCAATGGTAGAGCACTCGGCTGTTAACCGAGGGGTTGTTGGTTCGAGTC |
Downstream region at tRNA end position |
aataaggccc |
Secondary structure (Cloverleaf model) | >WENV170013000 Asn GTT g Gttt aataaggccc T - A C - G C - G T + G C - G A - T A - T T G T C A A C C A A A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T A A GGGTT C - G T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |