Sequence ID | >WENV170013003 |
Genome ID | ASRQ01004275 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 200 |
End posion on genome | 127 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
taattattag |
tRNA gene sequence |
CTGGGTGTGGCTCAGTTTGGTAGAGCGCTAGACTGGGGGTCTAGAGGTCGCAGGTTCAAG |
Downstream region at tRNA end position |
tcatactcaa |
Secondary structure (Cloverleaf model) | >WENV170013003 Pro GGG g Atga tcatactcaa C - G T - A G - C G - C G + T T - A G - C T G T T G T C C A T G A G + | | | | A T C T C G G C A G G C T | | | | T T G G A G C G T A G AGGTC C - G T - A A - T G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |