Sequence ID | >WENV170013007 |
Genome ID | ASRR01000004 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 51413 |
End posion on genome | 51337 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
caaaatcgtt |
tRNA gene sequence |
CGGAGTATAGCGCAGTCTGGTAGCGTGCTACCTTGGGGTGGTAGAGGTCGTCGGTTCAAC |
Downstream region at tRNA end position |
tacttatttt |
Secondary structure (Cloverleaf model) | >WENV170013007 Pro GGG t ACCA tacttatttt C - G G - C G - C A - T G - C T - A A - T T C T C G G C C A T G A A | + | | | A C C G C G G T C G G C T | | | + T T G G C G T G T A G AGGTC C - G T - A A - T C - G C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |