Sequence ID | >WENV170013016 |
Genome ID | ASRR01000060 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 16186 |
End posion on genome | 16261 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
caaaattgat |
tRNA gene sequence |
GGCTCGGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
tttnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013016 Phe GAA t ACCA tttnnnnnnn G - C G - C C - G T C C - G G - C G + T T T T C T G T C A T G A A | | | | | G C C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |