Sequence ID | >WENV170013027 |
Genome ID | ASRR01000266 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 716 |
End posion on genome | 802 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttgcggatta |
tRNA gene sequence |
GCGGCCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACTCCCGTG |
Downstream region at tRNA end position |
tatcaaaaag |
Secondary structure (Cloverleaf model) | >WENV170013027 Leu GAG a ACCA tatcaaaaag G - C C - G G - C G - C C - G C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGTAACTCCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |