Sequence ID | >WENV170013031 |
Genome ID | ASRR01000316 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 3918 |
End posion on genome | 3842 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aactctcagt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTAGCGCACTTCGCTGGGGGTGAAGGGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
ttaacttccc |
Secondary structure (Cloverleaf model) | >WENV170013031 Pro GGG t ACCA ttaacttccc C - G G - C G - C A - T G - C C - G G - C T A T T A T C C A C G A A + | | | | G C C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G G + T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |