Sequence ID | >WENV170013032 |
Genome ID | ASRR01000332 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 208 |
End posion on genome | 132 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgcatgtttt |
tRNA gene sequence |
GGCCCCGTAGCTCAGATGGATAGAGCAACCGCCTCCTAAGCGGTAGGTCGCGCGTTCGAC |
Downstream region at tRNA end position |
cttttcctcg |
Secondary structure (Cloverleaf model) | >WENV170013032 Arg CCT t ACCA cttttcctcg G - C G + T C - G C - G C - G C - G G - C T C T C G C G C A A G A A | | | | | G T C T C G G C G C G C G | | | | T T G G A G C A T A A AGGTC A - T C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |