Sequence ID | >WENV170013037 |
Genome ID | ASRR01000483 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 3480 |
End posion on genome | 3405 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
agtttggtga |
tRNA gene sequence |
GCCGCTGTAGCTCAGTTGGTAGAGCAACGCATTCGTAATGCGTGGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
tctttctttg |
Secondary structure (Cloverleaf model) | >WENV170013037 Thr CGT a ACCA tctttctttg G - C C - G C - G G - C C - G T - A G - C T G T T A T C C A T G A A + | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC A - T C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |