Sequence ID | >WENV170013039 |
Genome ID | ASRR01000591 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 279 |
End posion on genome | 353 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
actgtcgtgt |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCATCGGTTTTTGGTATCGTGTATCGTAGGTTCGAATC |
Downstream region at tRNA end position |
caatcttccc |
Secondary structure (Cloverleaf model) | >WENV170013039 Gln TTG t GCCA caatcttccc T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTATC T T C - G G - C G + T T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |