Sequence ID | >WENV170013042 |
Genome ID | ASRR01000729 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 326 |
End posion on genome | 402 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tcgcgagatt |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
tgtttcctgc |
Secondary structure (Cloverleaf model) | >WENV170013042 Arg CCG t GCCA tgtttcctgc G - C C - G A - T C - G C - G C - G G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |