Sequence ID | >WENV170013043 |
Genome ID | ASRR01000818 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 662 |
End posion on genome | 747 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctcctcacgt |
tRNA gene sequence |
GCCCCTGTGGCGGAACTGGTAGACGCGGTAGATTCAAAATCTGCTGTCCACTGGACGTGC |
Downstream region at tRNA end position |
tttttccttg |
Secondary structure (Cloverleaf model) | >WENV170013043 Leu CAA t ACCA tttttccttg G - C C - G C - G C - G C - G T - A G - C T G T C G G G C A C A A G | | | | | G T G G C G G C C C G C G | | | T T G A C G C T A G G TGTCCACTGGACGT G - C T + G A - T G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |