Sequence ID | >WENV170013044 |
Genome ID | ASRR01000828 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 235 |
End posion on genome | 311 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gtcgattgat |
tRNA gene sequence |
GGGCCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
tttattgagg |
Secondary structure (Cloverleaf model) | >WENV170013044 Ile GAT t ACCA tttattgagg G - C G - C G - C C - G C - G G - C G + T T G T C C A C C A G G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |