Sequence ID | >WENV170013045 |
Genome ID | ASRR01000828 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 346 |
End posion on genome | 421 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gggtttatct |
tRNA gene sequence |
GGGGCCATAGCTCAGTTGGGAGAGCGCCTGCTTTGCAAGCAGGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
atttttgttt |
Secondary structure (Cloverleaf model) | >WENV170013045 Ala TGC t ACCA atttttgttt G - C G - C G + T G - C C - G C - G A - T C T T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |