Sequence ID | >WENV170013048 |
Genome ID | ASRR01000931 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1026 |
End posion on genome | 1102 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acattggtat |
tRNA gene sequence |
GCAGTCGTAGCTCAGTTGGTTAGAGCGTCGGATTGTGGCTCCGAAGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
tttttccctt |
Secondary structure (Cloverleaf model) | >WENV170013048 His GTG t ACCA tttttccctt G + T C - G A - T G - C T - A C - G G - C T A T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC T - A C - G G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |