Sequence ID | >WENV170013050 |
Genome ID | ASRR01001025 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 341 |
End posion on genome | 251 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctcaaatcaa |
tRNA gene sequence |
GGACAGATGGGTGAGTTGGCTGAAACCACCTCCCTGCTAAGGAGACGTACTGGCAACGGT |
Downstream region at tRNA end position |
tttgtttcat |
Secondary structure (Cloverleaf model) | >WENV170013050 Ser GCT a GCCA tttgtttcat G - C G - C A - T C - G A - T G - C A - T T A T C T C C C A T T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACTGGCAACGGTACC C A C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |