Sequence ID | >WENV170013052 |
Genome ID | ASRR01001030 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1466 |
End posion on genome | 1541 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tttgcgaagt |
tRNA gene sequence |
AGGGGTGTAGCTCAGCTGGTAGAGCATCGGTCTCCAAAACCGAGGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
tttcgcactt |
Secondary structure (Cloverleaf model) | >WENV170013052 Trp CCA t GCCA tttcgcactt A - T G - C G - C G - C G - C T + G G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |