Sequence ID | >WENV170013054 |
Genome ID | ASRR01001211 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1365 |
End posion on genome | 1435 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ctttgccgtt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACACCAGCCTTCCAAGCTGGATACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
ttttatgccc |
Secondary structure (Cloverleaf model) | >WENV170013054 Gly TCC t Tttt ttttatgccc G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A A ATAC C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |