Sequence ID | >WENV170013056 |
Genome ID | ASRR01001300 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 823 |
End posion on genome | 738 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgatttctac |
tRNA gene sequence |
GCGGACGTGGTGGAATTGGTATACACAGCAGACTTAAAATCTGCCGGCCCTAGGCTATAC |
Downstream region at tRNA end position |
ttcttttttc |
Secondary structure (Cloverleaf model) | >WENV170013056 Leu TAA c ACCA ttcttttttc G - C C - G G - C G - C A - T C - G G - C T G T T G C C C A T A A G | | | | | A T G G T G A C G G G C G | | | T T G A C A C T A T A CGGCCCTAGGCTAT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |