Sequence ID | >WENV170013059 |
Genome ID | ASRR01002173 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1165 |
End posion on genome | 1090 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
nnggcattaT |
tRNA gene sequence |
GGGGCACTAGCTCAGTCGGCTAGAGCACTAGACTTTTAATCTAGGTGTCCCGGGTTCGAG |
Downstream region at tRNA end position |
aacacacagt |
Secondary structure (Cloverleaf model) | >WENV170013059 Lys TTT T ATta aacacacagt G - C G + T G - C G - C C - G A - T C - G T G T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C C T A A GTGTC C - G T - A A - T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |