Sequence ID | >WENV170013060 |
Genome ID | ASRR01002358 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 455 |
End posion on genome | 528 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gttcttattT |
tRNA gene sequence |
GTCCTCATAGTTAAATGGATATAACCGGGACCTCCTAAGTCTCAATTCTAGGTTCGATTC |
Downstream region at tRNA end position |
aaaagagcat |
Secondary structure (Cloverleaf model) | >WENV170013060 Arg CCT T GTta aaaagagcat G - C T - A C - G C - G T + G C - G A - T T T T G A T C C A T A A A | | | | | G G A T T G C T A G G C G | | | | T T A T A A C T A C AATT G - C G + T G - C A - T C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |