Sequence ID | >WENV170013062 |
Genome ID | ASRR01003164 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 88 |
End posion on genome | -1 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tagcgcgttt |
tRNA gene sequence |
GGAGAAGTACCCAAGCGGCTGAAGGGGCTCGCCTGGAAAGTGAGTAGGTCGTTAATAGCG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013062 Ser GGA t NNnn nnnnnnnnnn G - C G - C A - T G - C A - T A - T G - C T A T C T C C C A C G A A | | | | | A G A C C C G A G G G C G | | | T T C A G G G T G A G TAGGTCGTTAATAGCGGCGC C - G T - A C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |