Sequence ID | >WENV170013063 |
Genome ID | ASRR01003405 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 736 |
End posion on genome | 811 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcaataaagt |
tRNA gene sequence |
GCCCGGATAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGTGGTTCGAAT |
Downstream region at tRNA end position |
ttttnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013063 Phe GAA t ACCA ttttnnnnnn G - C C - G C - G C - G G - C G - C A - T T A T C C G C C A T G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |