Sequence ID | >WENV170013064 |
Genome ID | ASRR01004281 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 520 |
End posion on genome | 444 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttcaacttaa |
tRNA gene sequence |
CGCGGAATAGAGCAGTCAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACAAGTTCAAA |
Downstream region at tRNA end position |
atcaaaaaac |
Secondary structure (Cloverleaf model) | >WENV170013064 Met CAT a ACCA atcaaaaaac C A G - C C - G G - C G - C A - T A - T T A T T G T T C A T G A A | | | | | A C C G A G A C A A G C A | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |