Sequence ID | >WENV170013066 |
Genome ID | ASRR01005730 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 92 |
End posion on genome | 3 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aatgcttcaT |
tRNA gene sequence |
GGAGAAGTACCCAAGTGGCTGAAGGGTCCGCACTCGAAATGCGGTAGGCGGCTTGCGCCG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013066 Ser CGA T GTtt nnnnnnnnnn G - C G - C A - T G - C A - T A - T G - C T A T C T C C C A T G A A | + | | | A G A C C C G G G G G C G | | | T T C A G G G T G A T TAGGCGGCTTGCGCCGTGC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |