Sequence ID | >WENV170013068 |
Genome ID | ASRR01006574 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 50 |
End posion on genome | 134 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cgaagaattt |
tRNA gene sequence |
GGAGGAGTGTCCGAGTGGTTAAAGGAGACGGACTGTAAATCCGTTCGCTTAGCGTACGCT |
Downstream region at tRNA end position |
tttcttcgct |
Secondary structure (Cloverleaf model) | >WENV170013068 Tyr GTA t ACCA tttcttcgct G - C G - C A - T G - C G - C A - T G - C T A T C G A C C A T G A G | | | | | G G G C C T G C T G G C G | | | T T T A G G A T A A G TCGCTTAGCGTAC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |