Sequence ID | >WENV170013070 |
Genome ID | ASRR01008763 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 210 |
End posion on genome | 137 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cattatccca |
tRNA gene sequence |
GGGCGCATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
gagagaatat |
Secondary structure (Cloverleaf model) | >WENV170013070 Val TAC a ACtc gagagaatat G - C G - C G - C C - G G - C C - G A - T C G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |