Sequence ID | >WENV170013075 |
Genome ID | ASRR01010988 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 100 |
End posion on genome | 183 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttccgccaat |
tRNA gene sequence |
GGAGTAGCTGGGCACTGGGGAGCCCACCGGACTGTAAATCCGACGCTTATAGCTGTGCTG |
Downstream region at tRNA end position |
atagagagtg |
Secondary structure (Cloverleaf model) | >WENV170013075 Tyr GTA t ACCA atagagagtg G - C G - C A - T G - C T - A A - T G - C T T C C G A C C A T C A T | | | | | A G C G G G G C T G G C G | | | | T T G G C C C G A A CGCTTATAGCTGT C A C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |