Sequence ID | >WENV170013087 |
Genome ID | ATLU01000002 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 136503 |
End posion on genome | 136579 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgtgtgaat |
tRNA gene sequence |
GGCGTGGTAGCTCAGCTGGTTAGAGCACAGCACTCATAATGCTGGGGTCGGCGGTTCAAG |
Downstream region at tRNA end position |
cacgaaaact |
Secondary structure (Cloverleaf model) | >WENV170013087 Met CAT t ACCA cacgaaaact G - C G - C C - G G - C T - A G - C G - C T G T C C G C C A C G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |