Sequence ID | >WENV170013092 |
Genome ID | ATLU01000005 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 106438 |
End posion on genome | 106352 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cacgacacct |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCCAGCTTCAGGTGCTGGTGTCTGTATGGACGTG |
Downstream region at tRNA end position |
ctttaaccaa |
Secondary structure (Cloverleaf model) | >WENV170013092 Leu CAG t ACCA ctttaaccaa G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGTCTGTATGGACGT C - G C - G A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |