Sequence ID | >WENV170013096 |
Genome ID | ATLU01000011 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 48703 |
End posion on genome | 48778 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
actgcaatac |
tRNA gene sequence |
GCCACCCTAGCTCAGTTGGTAGAGCGCATCACTCGTAATGATGAGGCCGCCGGTTCGATT |
Downstream region at tRNA end position |
ccactcaaac |
Secondary structure (Cloverleaf model) | >WENV170013096 Thr CGT c TCCA ccactcaaac G - C C - G C - G A - T C - G C - G C - G T T T C G G C C A T G A A | | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A G AGGCC C - G A - T T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |