Sequence ID | >WENV170013098 |
Genome ID | ATLU01000011 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 124460 |
End posion on genome | 124385 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctcgtttttg |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAGCTGATTTGTAATCAGCAGGTCGCGGGTTCGACT |
Downstream region at tRNA end position |
ttttattcct |
Secondary structure (Cloverleaf model) | >WENV170013098 Thr TGT g TCCA ttttattcct G - C C - G T - A G - C G - C C - G G - C T C T T G T C C A T G A A + | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |