Sequence ID | >WENV170013104 |
Genome ID | ATLU01000014 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 45284 |
End posion on genome | 45357 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gccctgcaat |
tRNA gene sequence |
TGGGGATTCGTCTAACGGCAGGACTACGGACTCTGACTCCGTCAGTGGAGGTTCGAATCC |
Downstream region at tRNA end position |
aattgaatca |
Secondary structure (Cloverleaf model) | >WENV170013104 Gln CTG t GCCA aattgaatca T - A G - C G - C G - C G - C A - T T - A T A T C C T C C A A A C | | | | | G C T C T G G G A G G C G + | | | T T G G G A C C A T CAGT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |