Sequence ID | >WENV170013105 |
Genome ID | ATLU01000015 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 34278 |
End posion on genome | 34354 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
agacatttac |
tRNA gene sequence |
GCCCCCGTAGCTCAGCTGGATAGAGCATCCCCCTCCTAAGGGGAAGGTCACACGTTCGAA |
Downstream region at tRNA end position |
tcaggtcaac |
Secondary structure (Cloverleaf model) | >WENV170013105 Arg CCT c GCCA tcaggtcaac G - C C - G C - G C - G C - G C - G G - C T A T T G T G C A C G A A | | | | | G T C T C G A C A C G C G | | | | T T G G A G C A T A A AGGTC T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |