Sequence ID | >WENV170013106 |
Genome ID | ATLU01000018 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 90413 |
End posion on genome | 90337 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agtgcgccgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCGTCTGTTTTGGGTACAGAAGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
ttttccgtca |
Secondary structure (Cloverleaf model) | >WENV170013106 Pro TGG t ACCA ttttccgtca C - G G - C G - C G - C G - C C - G G - C T A T C G C T C A C G A A | + | | | G C C G C G G T G A G C T | | | | T T G G C G C G T A G AGGTC T - A C - G T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |