Sequence ID | >WENV170013108 |
Genome ID | ATLU01000024 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 50201 |
End posion on genome | 50276 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccgcagcgtt |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCGTCGTTCGCAATGACGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
aatccctccc |
Secondary structure (Cloverleaf model) | >WENV170013108 Ala CGC t ACCA aatccctccc G - C G - C G + T G - C C - G C - G G - C C T T T A G C C A T G A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G G - C T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |