Sequence ID | >WENV170013112 |
Genome ID | ATLU01000025 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 34701 |
End posion on genome | 34617 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cttggcgctg |
tRNA gene sequence |
GCCCGCGTGGTGGAATGGTAGACACTGGGGACTTAAAATCCCTTGGCTTAATGCCGTGCC |
Downstream region at tRNA end position |
gcgaaatcag |
Secondary structure (Cloverleaf model) | >WENV170013112 Leu TAA g ACCA gcgaaatcag G - C C - G C - G C - G G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G T TGGCTTAATGCCGT G + T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |