Sequence ID | >WENV170013114 |
Genome ID | ATLU01000027 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 17887 |
End posion on genome | 17963 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gtccggtcat |
tRNA gene sequence |
CGGGGTATAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tttttttcga |
Secondary structure (Cloverleaf model) | >WENV170013114 Pro TGG t ACCA tttttttcga C - G G - C G - C G - C G - C T - A A - T T A T C T C T C A T G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |