Sequence ID | >WENV170013115 |
Genome ID | ATLU01000027 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 17978 |
End posion on genome | 18054 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttcgatcat |
tRNA gene sequence |
GCGCCCGTAGCTCATTTGGATAGAGCATCGGCCTTCTAAGCCGAGGGTAGCAGGTTCGAA |
Downstream region at tRNA end position |
agttctttac |
Secondary structure (Cloverleaf model) | >WENV170013115 Arg TCT t GCCA agttctttac G + T C - G G - C C - G C - G C - G G - C T A T C G T C C A T T A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTA T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |