Sequence ID | >WENV170013117 |
Genome ID | ATLU01000027 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 18156 |
End posion on genome | 18231 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ccataaattt |
tRNA gene sequence |
GGGCCATTAGCTCAGCTGGTAGAGCAGTGGACTCTTAATCCATTGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
gaatgaaatc |
Secondary structure (Cloverleaf model) | >WENV170013117 Lys CTT t ACCA gaatgaaatc G - C G - C G - C C - G C - G A - T T - A T A T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |