Sequence ID | >WENV170013126 |
Genome ID | ATLU01000035 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 62011 |
End posion on genome | 62084 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aattgcctgt |
tRNA gene sequence |
GCGGGTGTTGTGTAATGGTAAGACCCTTGCCTTCCAAGCAAGAGATACGGGTTCGATTCC |
Downstream region at tRNA end position |
agcacacatg |
Secondary structure (Cloverleaf model) | >WENV170013126 Gly TCC t TCCA agcacacatg G - C C - G G - C G - C G - C T - A G - C T T T T G C C C A A A T | | | | | G T T G T G A C G G G C G | | | T T G A G A C T A C AGAT C - G T - A T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |