Sequence ID | >WENV170013127 |
Genome ID | ATLU01000037 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 50896 |
End posion on genome | 50820 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccgccacggt |
tRNA gene sequence |
CGGAGCGTAGCTCAGCCTGGTAGAGCACTGTCTTCGGGAGGCAGGGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
ataaaacaag |
Secondary structure (Cloverleaf model) | >WENV170013127 Pro CGG t ACCA ataaaacaag C - G G - C G - C A - T G - C C - G G - C T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGCC C - G T - A G - C T + G C - G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |