Sequence ID | >WENV170013128 |
Genome ID | ATLU01000040 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1540 |
End posion on genome | 1616 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gcgcgggcac |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCATAGGTTCGAA |
Downstream region at tRNA end position |
ttcactacag |
Secondary structure (Cloverleaf model) | >WENV170013128 Arg CCG c GCCA ttcactacag G - C C - G A - T C - G C - G C - G G - C T A T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |