Sequence ID | >WENV170013129 |
Genome ID | ATLU01000044 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 52656 |
End posion on genome | 52581 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ctgatataat |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGACC |
Downstream region at tRNA end position |
ttcccctacg |
Secondary structure (Cloverleaf model) | >WENV170013129 Ala GGC t ACCA ttcccctacg G - C G - C G + T G - C C - G C - G T - A C C T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |