Sequence ID | >WENV170013141 |
Genome ID | ATLU01000057 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 30597 |
End posion on genome | 30522 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgccttcatc |
tRNA gene sequence |
GGGTGCTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCGGGGGTTCGATC |
Downstream region at tRNA end position |
tatttggagc |
Secondary structure (Cloverleaf model) | >WENV170013141 Val TAC c ACCA tatttggagc G - C G - C G - C T - A G - C C - G T - A C T T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |