Sequence ID | >WENV170013144 |
Genome ID | ATLU01000068 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 34725 |
End posion on genome | 34798 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gcagcgcaca |
tRNA gene sequence |
GCGGGTATCGTATATCGGTATTACCCTAGCTTCCCAAGCTAGTGAGGCGGGTTCGACTCC |
Downstream region at tRNA end position |
gttttttctc |
Secondary structure (Cloverleaf model) | >WENV170013144 Gly CCC a TCCA gttttttctc G - C C - G G - C G - C G - C T - A A - T T C T C G C C C A T A C | | | | | G C T A T G G C G G G C G | | | T T G T T A C T A C TGAG C - G T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |