Sequence ID | >WENV170013145 |
Genome ID | ATLU01000068 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 40522 |
End posion on genome | 40597 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ccctcgccaa |
tRNA gene sequence |
GGCTAGGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGCAGTTCGATT |
Downstream region at tRNA end position |
tacatcaagc |
Secondary structure (Cloverleaf model) | >WENV170013145 Phe GAA a ACCA tacatcaagc G - C G - C C - G T + G A - T G - C G - C T T T C T G T C A T G A A | + | | | G T C T C G G G C A G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |