Sequence ID | >WENV170013148 |
Genome ID | ATLU01000075 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 28915 |
End posion on genome | 28842 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaagaaaaat |
tRNA gene sequence |
GGCTGAGTAGCAAAGTGGTTATGCAGCGGTTTGCAAAACCGTCTACCTCGGTTCGACTCC |
Downstream region at tRNA end position |
ttttttatcc |
Secondary structure (Cloverleaf model) | >WENV170013148 Cys GCA t TCCA ttttttatcc G - C G - C C - G T - A G - C A - T G - C T C T G G G C C A G A A | + | | | G T A A C G C T C G G C G | | | T T G A T G C T T A CTAC G + T C - G G - C G - C T - A T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |