Sequence ID | >WENV170013149 |
Genome ID | ATLU01000075 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 28815 |
End posion on genome | 28728 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gacagaccct |
tRNA gene sequence |
GCCCGGGTGGCGAAATTGGTAGACGCAGCGGACTTAAAATCCGCCGGTCATTGCGACCGT |
Downstream region at tRNA end position |
ttctttattt |
Secondary structure (Cloverleaf model) | >WENV170013149 Leu TAA t ACCA ttctttattt G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | A T A G C G G C C G G C G | | | T T G A C G C T A G A CGGTCATTGCGACCGT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |