Sequence ID | >WENV170013151 |
Genome ID | ATLU01000083 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 33676 |
End posion on genome | 33601 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ctcgacacat |
tRNA gene sequence |
TCCTCGGTAGCTCAGTTGGTAGAGCGGGTGACTGTTAATCACTAGGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
aacaaaacaa |
Secondary structure (Cloverleaf model) | >WENV170013151 Asn GTT t GCCA aacaaaacaa T - A C - G C - G T - A C - G G - C G - C C G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G AGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |