Sequence ID | >WENV170013153 |
Genome ID | ATLU01000084 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 28486 |
End posion on genome | 28562 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gccctcttca |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
atttcaatgg |
Secondary structure (Cloverleaf model) | >WENV170013153 Arg CCG a GCCA atttcaatgg G - C C - G G - C C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | A T C T C G A C A G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |